The synthetic double-stranded oligonucleotide (Sense: 5’- GATCCGACGACGACGCGCGCGCGACGACGAGATC; Anti-sense: 5’- GATCTCGTCGTCGCGCGCGCGTCGTCGTCGGAC) is used as a substrate for DNA methyltransferase 3A (DNMT3A).
Catalog No. D53-58
Catalog No. | Pack Size | Price (USD) | |
---|---|---|---|
D53-58-05 | 5 ug | $105 | |
D53-58-BULK | BULK | Contact Us |
No overview information available.
Storage, Stability and Shipping:
Store product at –20oC. For optimal storage, aliquot diluted product into smaller quantities and store at recommended temperature. For most favorable performance, avoid repeated handling and multiple freeze/thaw cycles.
Molecular Weight:
The size of double-stranded oligonucleotide is 34 base pairs. The molecular weight is 20891.54.
Format:
White to off-white lyophilized powder.
There are no related publications available for this product.
Apoptosis/Autophagy, Cancer, Cell Cycle, Neurobiology
STAY CONNECTED
Fax: 1-604-232-4601